Read::getDigiNormMultiplier();

eventually cache a boolean for quick yes/no?

-----------------------------------

removing pcr duplicates (solexa)

work on pairs per read group: need to have the same direction, length and same crc32/md5 for segment pairs

eg

pair 1   + aaaa/1           - gggg/2
pair 2   + aaaa/1           - gggg/2
pair 3   + aaaa/1           - gggg/2

but not
         + aaa/1            - gggg/2
         + aaTa/1           - gggg/2
         + aaaa/2           - gggg/1
         - aaaa/1           + gggg/2


Then (for genomes only?):
if readgroup had "enough" duplicates seen earlier and/or if hashstats avg freq
"OK", remove single read duplicate: same length, same crc32/md5, same segment


Then (for genomes only?):
analyse contig for pcr dup patterns (same start, same end)

-----------------------------------

-SB:abnc gives totally weird results (first 2kb bs168)

-----------------------------------

John, bughunt, SEnt small map
HWI-ST724:221:C1BU4ACXX:5:1102:16881:253
misaligned!!!!

problem goes away after git 426f466a946300e8d84ab66043cd6cc2831596fa
but it's just because the misalignment bug is not triggered anymore
need to still hunt down.

-----------------------------------

phix174 clipping: make hashstat disappear to directory

-----------------------------------

Titus:
digital normalisation include in MIRA?
Read: median of kmer frequency >= threshold, throw away
MIRA: keep reads which have untaken kmers >= threshold (+/-)
MIRA: get average kmer cov x, norm average coverage to y<x with y ~ 5-10
MIRA: keep read-pairs
Problem est/RNASeq: unprocessed mRNA

kmer include in MIRA?

kmer: max k?

digital normalisation of partitioning for metagenomics / est???

trinity recommends diginorm for rnaseq

-----------------------------------

walkthrough for NCBI data: loading .fna, .gff3 and assembly of SRA

-----------------------------------

docs for -CL:pmkfr:cbse

-----------------------------------

resume mapping assemblies! (is that needed or "simply not supported"?

need to save backbone sequences and rails as contigs, taking them out of
normal readpool.maf. This would/might destroy read order ... need to also save read
order in readpool.

-----------------------------------

move Read::isUsedInAssembly() to Assembly
---> merge with other flags into a bitfiled?


-----------------------------------
EST:

categorise reads as possible introns by coverage within a contig if no SRMc

-----------------------------------

reactivate TCS


-----------------------------------

document ltr2mfsm, mfsm tags
make user able to define own tags to mfsm

document fcov example

document clipping options of -CL:pec group, -CL:rkm

-----------------------------------

> During the 3 steps of the miraSearchESTSNPs pipeline I encountered several
> problems, that were overcome with a few scamotages that Im not sure were
> properly addressed. First of all, I had problems in highering the assembly
> stringency (I mean avoiding the introduction of too many gaps in the
> assembly). It seems step 2 considers input sequences as Sanger even if my
> dataset is only composed by 454 sequences, so I had to add parameters
> regulating the assembly stringency also as SANGER_SETTINGS  to the command
> line.

Oooops ... you sure about that? I'll need to have a look at that one.
--------------------------------

idee: count how often read is incorporated in contigs without involvement in 
 new SRMc. last pass: throw out / remove well connected status for reads
 never OK
idee: lastpast, cut back ends not covered by HAF tags (+2 into HAF??)

--------------------------------

implement BLOOM filter for shash statistics as pre-filter
First pass BLOOM, storing hashes >= 2x in the filter

--------------------------------

document -CL:msvssfc:msvssec

--------------------------------


Contig: transpose SRMr tags to SRMr/CRMr tags in reads not tagged yet

--------------------------------

U13 with qual clips: some 100% matching contigs not assembled???

--------------------------------
test on aciadp1, 454pe lib contaminated with peanut mRNA

-----------------------------------
document/parametrise skim.C analyseHashes(): fwdrevmin
document: -OUT:org3
-----------------------------------

implement VCF, BED

scere artificial: pass 2
400m edges added by rsh4_takeReptPEPEHitsThatExtend(20,100,fname, blockpos,
blocklen);
-> rethink strategy of that func


--------
> Also, could you include the MIRA version number in the MAF file, and the
> command line used to invoke it? This would be useful for tracking how all
> my difference assemblies were created.

Hmmm, not sure whether I want to do this. I initially wanted to have some
   comment fields in MAF format, but did not come around implementing
   them. Give me some time to think this through.
-------

replace INCLUDES in Makefile.am with CXXFLAGS=-I... // progs: look at itxt

configurable: 64 instead of 16 files for hstat.


aci_adp: hybrid ... SRMr tags set only in 454 reads, not sxa???




-----------------------------------------------------------------------------
Problem: Very, very spurious overhang misassemblies. All HAF3. If detectable,
   then only by setting endreadmarkexclusionarea to 0 (too dangerous).

1.4 MB contigs in BS

..................xx.
................*x*xx
................*x*xxx
................*x*xxxx
................x.........................
..........................................
      xxxxx...............................
       xxxx...............................
        xxx...............................
         xx...............................
------------------------------------------------------------------------------

document order of file creation
document hard/soft Solexa filters

EZRJ5AL02JMKBG
E0K6C4E01EE4FA
E0K6C4E02HKBO6
E0K6C4E02JD918
E0K6C4E02F3T1Y
E0K6C4E02G544S


read.C
loadDataFromEXP(): reactivate/convert swapTags()
initialiseRead(): reactivate/convert adding tags

EST:
 mask at X times hash in project


mapping: Gogo: try whether mapping indels first is better!
overlapcompressstepping in buildFirstContigs(): check whether functional!
fasta2frag: continue mutation

skim: fullencasing erlaubt bei EST?

memorysave: read
nuke forward/complement?

allow reads without adjustments (done, now allow dynamic re-enabling)


bceti: prfen ob

FF5UQ0101A62BE.fn
FFPHEER01DATWZ
FFPHEER01AK3C0

sich als join spoiler verraten durch anzahl overlapextends links / rechts
(oder verhltnis oder so)

bceti: urdsip=4 trotzdem in pass 4 noch coverage >500???


4705: rails am ende (funktioniert eh nicht derzeit). hngt auf nach Assembly bei
   Searching for SNPs and IUPACs, preparing needed data ...



setvbuf ( pFile , NULL , _IOFBF , 1024 );


==================================
DOCUMENTATION
==================================




use
http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?run=SRR005481&cmd=viewer&m=data&s=viewer
and
http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?run=SRR005482&cmd=viewer&m=data&s=viewer
to write a paired / unpaired 454 assembly guide


use 

SRR005677 (Acinetobacter sp. ATCC 27244) Solexa + 454




- NONO the functionality of propose cutbacks now also takes into account
  forward/reverse presence of clean ends for 454 and Solexa data.



==================================
HIGHEST PRIORITY (2.9.x)
==================================

idea: pass 1: no ads_enforce_clean_ends, no editing, 
      pass 2: switch on enforce
      pass 3: switch on editing (or in pass2?)
      after 2 rounds edit, recalc *all* reads with SRM/WRM 



skim:
- (eventually, if easy, else later): prefer to write skim results with non-mc
  overlaps


Hmmm... bs168:
- sequencing bias. Idea: if more than x reads align at same position, same
direction and have same length, remove some (EZRJ5AL02FOGB8 EZRJ5AL02FVAKW)
and (E0K6C4E02HY6PS E0K6C4E02I9JDB)

Problem bs168 pass3
E0K6C4E02GWD5E EZRJ5AL02GD876 (alignment end protection would have
helped). Idea: perhaps sub-critical SRMr mismatches. If more than 15 in a 30
stretch: mark SMRr?


convert_project: ohne -y keine statistiken ber large contigs :(((

bceti: FFPHEER01EYB6A, FFPHEER01EYIHS do not find perfect 42 bases overlap to
FFPHEER01BSB83 ??? -> reduce skim: take left and right extensions of every
read!!! (or does it get thrown out earlier?)



ETX12BK02HGFOM in ecoli paper project: alignment of multicopy against backbone
-> in higher passes, transpose SRMr tags and reject alignment

CCCCAGTAGCGGCGAGCGAACGGGGAGCAGCCGAGTGGTTTCATACGCGTGAA*GTTC*TGCAATAGT  ETX12B...
CCCCAGTAGCGGCGAGCGAACGGGGAGCAGCCCAGAGCCTGAATCAGTATGTGTGTTAGTGGAAGCGT  cons
                                   x  x xx  xx xx  xxx   xx     xxx



replace -AL:egpl with mechanism not in Align class (for handling different
strains)
weiter maxgapcounter in align, have contig reject codon gaps and
these reads set as need all overlaps (analysis function)



assembly_info: number of reads with SRMr, resolved SRMr (SRMc) positions

BUG: "convert_project -f CAF -t ace" does not have same ouput as original
ACE??? The quality values are totally different???

delete MRMr tags at SRMr positions?

454 Regel: Qual-3 oder -2 fr SRMr wenn 8 / Basegroup und + / -

Wenn -SK:mnr benutzt wird ... skimfilter auch alle SRMr/SRMr hits?

check gnl|ti|1251406489 in spneu to bb hyb


-highlyrepetitive: add -AS:urd and pass? change -SK:rt?

STMS tags set on N in Solexa reads (other error before, but this should not
happen neither)

contig_analysis.C: Must account for mapped reads in nmpr_firstfillin() or
nmpr_rategroups() and the rest of the newrepeatmarker();


contig.C: add options to parametrise the short read clippings
contig.C: add options to parametrise short read acceptance upon number and
          type of errors.

assembly.C/contig.C: check which align to take when using hybrids.
rethink in hybrid assemblies (and different strains): parametrisation of
align, which to take? tough when same strain and seq.tech, bit more lenient
else? (example of rrna stretches in Bsub with one codon more / less)


Contig: USCLO_SWALIGN (when mapping Solexa) shows time dependency of unknown
        factor. Why????????? From 300k to 1m reads -> slow. At 1.2mio reads,
        fast again.

In contigs: transpose SRMr tags in non-SRMc columns to CRMr in other reads (if
there are more than 2, 3, 4, 5, ... other bases). To prevent aligning of SRMr
tagged sequences with non-SRMr sequences that have another base)

Also: mapping: no tag transposal to backbone???

Loading backbone: are SRMr tags transposed to rails??? (they must be!)


==================================
HIGH PRIORITY
==================================

feature analysis: uppercasing /lowercasing sequences on mutation does not work
for feature strain???


print some cluster/debris info after clustering

put strain info to rails?

GBF: "ncRNA" are "gene" after gbf in assembly, caf->gap4->caf->gbf

GBF: write "/codon_start" and "/transl_table" (and have convert_proejct a
switch to choose the table


E0K6C4E02JXSHC (bs168) nachprfen warum mistig aligned? (ohne gap)

take x left/rightmost reads of each contig as "needalloverlaps"

parameters: -clippingXXX  for 454, SOLEXA & SOLID?

backbone assembly abnc=no: multicopy file no entry > 0 ???

test miraclip/mirapre

convert_project: caf2caf with -d deleteStarOnlyColumns() throws on GLL 14k

!!!!!!! STILL THERE??? GLL 7ksmall (and GLL full) after 1st pass:
        possible SRM tagged??? 138832_3005_0985 (pos 2657 in contig). miratest
        finds it???


Segfault! Mapping 454 reads, having first performed vector clipping and read
extension. (bb_500k for bs168)


==================================
MEDIUM PRIORITY
==================================

add some parameter that allows to set mask tags that MIRA will not use in
consensus computation (only if no other sequence is present). Needs als slight
changes to 

Maximum allowed coverage? (start in loop ...). Use 1.5x avg cov as general
threshold and 1.2x avg. cov for for "convicted multicopies" (rails can be
that, too)? But for mapping, allow reads when there's a position with a low
coverage (Solexa<6?), else "Canyon-SNPs" won't be found. (per round, else
after 6 mappings it's stopping)

cyanothece example (2.9.24x2 on): gnl|ti|1986108285 aligns with
gnl|ti|1986095147 with a 9bp gap (repeat which doesn't get tagged as SRMc but
only WRMc). Idea: switch on egp after given number of passes? Idea: as soon as
gaps involved >3bp morph WRMc -> SRMc?

TXT output of alignment: handle read names >20 or so characters
TXT output of alignment: sloooooooooooooow for Solexa assemblies

rework EST minidemo for new switches (once poly-A tagging works again (needs
skim masking))

problem: ">bla" as solexa input file (zero length seq) gives error

check parameter flexer for cases needing <<EOF>>

Assembly error with repeat and 2 strains. see
wrongassembly_problem3reads2strains. Must be fixed in Contig baselocks,
checkADSForMismatchworks

backbone assembly: first sanger (backbone quick, backbone normal), then 454
instead of first backbone quick (sanger, 454) and then backbone normal
(sanger, 454) ???

XML load: say which reads not covered by xml info?

NCBI XML: parse mate pairs
.
Improve template handling
-------------------------

parsing of templates

slimdown/beef-up cycle for contigs? (take out multicopy orphan templates,
rebuild) or even more sophisticated: when building and non-multicopy read
clashes in insert size with multicopy template partner, remove template
partner from contig)

alternative to beef-up/slim-down: align non-multicopy reads even if template
is wrong if template partner is multicopy, throw out multicopy template
partner from contig

---------------------------


SKIM: SRMr/CRMr als preferred match position mitziehen, wenn links & rechts
davon hits, dann muss auch da ein hit sein?

ODER: in reads mit SRMr/CRMr extra skim pass: nur die areas um die tags
hashen und vergleichen. im normalen pass wenn beide reads tags haben nicht
vergleichen.


-------------------------------------
check how to better implement AS_permanent_overlap_bans: this gets a memory
nightmare for highly repetitive 454 data
-------------------------------------


Idee (unbedingt/vielleicht?): read mit P454>=20% (und * mitspieler) und N in
homopolymer >= x (oder nur >2N) -> raus aus assembly


==================================
LOW PRIORITY
==================================

454
---
3 pass assembly also does the job pretty well: after 454 editing:
copyRebuildContig(). take reads from old contig and insert them in new contig,
getting clean alignments (stop if any read does not perform as
advertised). re-edit that.

read: changeQualityInSequence()? (baseruns) and align with lowest baserun qual
base set to lowercase?  
ACGTAGTCTGACCCcACGTACGT 
ACGTAGTCTGACCC*ACGTACGT


nukeSTLContainer also in Contig? In others?


AS_contigs.push_back(con) then AS_contigs.back().saveMem(); works. Doing it
the other way round a segfault????


==================================
ULTRALOW PRIORITY
==================================

option: tags in reads mappen auf consensus bei der ausgabe

contig
prfen, was bei PRMBs im backbone passiert (geladene PRMBs)

assembly
andere filetypen im backbone laden (fofnexp!)

permbanliste unbedingt um offset erweitern.

nicht geclippte mgliche Vectorleftovers merken, dann im contig
analysieren, evtl. spter rausclippen (wenn am Ende eines Contigs oder
wirklich als einziges drin)


uebl init wert parametrierbar: uebl als loop?

ban overlapping template partners von vornherein wenn gre nicht
stimmen kann?

replace FUNCSTART with __PRETTY_FUNCTION__ (portability?)
use __builtin_prefetch (portability)

alignment of Read::READTYPE_...consshred with same type -> replace bmin 
with fixed value (e.g.21 or similar) to speed up massive oversampling 

convert_project: CAF and other files with only reads: convert one read at a
time (to save memory)


==================================
TOCHECK
==================================

multithreading: to prevent locks in alignments: 1 thread grabs all possible
hits with first read equal


==================================
IDEAS
==================================

SRMs in SKIM: count seen hashes with SRM / expected hashes with SRM for an
additional percentage?

better and earlier repeat disambigueation: in additional alignments, use 3rd
pass with all skims. SRMr, CRMr (*and* overlaplen >X *and* % > 90%) *and*
_fresh_ repeat markers (having a comment != "")


compute overcompression clusters: from average coverage (evtl. only those
contigs without overcompression?), analyse contigs for coverage. At
overcompression sites (starting at 1.3x-2x average coverage?), bin reads
equally distributed into overcompression groups (OCG). then in subsequent
passes, allow reads that overlap with reads in an OCG only to overlap with
other reads of the same OCG.

SKIM / filter: multicopy must have "almost full overlap match"???

changed additional alignment iteration now also working on reduced
skim-hits. check whether working on full could be done

save memory: put newedges_t.best_weight into adsfact? (and then also test
speed impact if calculated on-the-fly)

save memory?: normalise newedges_t, put every rid1-hit into a vector

spneu log: pass 3 -> gnlti 1252169540: nonmulticopy weight 109850 mit 40/65% overlap???

put all read overlaping in contig at SRMs into list of additional alignments
to check after pass

with templates: look at at short orphans at ends of previous contig, try to
start with counterparts for next contig.



--------------------------------------------


TODO: smooth consed: abi->phred->phd->ace


--------------------------------------------








MAF Documentation


// Header

  // FV = format version: major minor
  // @R = num reads (optional)
  // @C = num reads (optional)
  // @L = length longest sequence (optional, treat as hint to minimise re-alloc, may be bigger)


// For reads

  // RD = Read name
  // LR = length read (length of unclipped sequence)
  // SQ = sequence (in one line, gaps as '*')
  // BQ = base quality (in one line, FASTQ-33 format)
  // SV = sequencing vector (name)
  // TN = template (name)
  // DI = direction (strand; 'F' or 'R' for forward/reverse)

  // TF = template size from (integer>=0 or -1 for "don't care")
  // TT = template size to (integer>=0 or -1 for "don't care")

  // SF = Sequencing File (file name with raw data like SCF file etc.pp)
  // BC = basecaller (name)

  // SL, SR = sequencing vector left / right cutoffs
  // QL, QR = quality left / right cutoffs
  // CL, CR = (other) clipping left / right cutoffs

  // AO = Align to Original (is align_to_scf from CAF: from to from to)

  // RT = Read Tag (identifier from to comment).

  // ST = sequencing type (Sanger, 454, Solexa, SOLiD
  // SN = strain name
  // MT = machine name

  // IB = is backbone (0 or 1)
  // IR = is rail (0 or 1)
  // IC = is Coverage Equivalent Read (0 or 1)

  // ER = End Read (marker for MAF parsing, mandatory)
